logo

Crowdly

Browser

Add to Chrome

BCH2011 - Structure and function of cellular biomolecules - S1 2025

Looking for BCH2011 - Structure and function of cellular biomolecules - S1 2025 test answers and solutions? Browse our comprehensive collection of verified answers for BCH2011 - Structure and function of cellular biomolecules - S1 2025 at learning.monash.edu.

Get instant access to accurate answers and detailed explanations for your course questions. Our community-driven platform helps students succeed!

In the process of revising for BCH2011, you fell asleep (understandable) but upon awakening you realised you dreamt of the titration of an amino acid side chain (understandable). The details of the dream are murky, but you recall it looking something like this:

Image failed to load

What is the pKa of the side chain and which amino acid were you dreaming of?

0%
0%
0%
0%
0%
0%
0%
View this question

The data below shows four different protein unfolding curves for the same protein but containing various mutations.

Image failed to load

The protein is 280 amino acids long. The N-terminal region of the protein involves a cluster of hydrophobic amino acids critical for stabilising the overall structure of the protein. The C-terminal region contains a solvent-exposed pocket containing charged amino acids that, whilst not so critical for protein folding, play an important role in the protein's function.

The mutations studied were as follows:

  • R247K
  • F38V
  • F38A

The wild-type (WT) version of the protein has been extensively studied and no mutation has ever been found that has improved stability.

Which condition corresponds to which version of the protein?

View this question

Let's start easy with something easy.

Here's a coding strand sequence, with each codon helpfully spaced by spaces and each codon numbered by numbers and with me writing more words than are necessary as some introductory text.

Image failed to load

Spot the stop.

0%
0%
0%
View this question

The following sequence is part of the coding strand of a gene, somewhere in the middle of the open reading frame (i.e. we're already in the correct frame and the initiating codon was upstream of this sequence).

TGCCATGCGCGCGGCGAAGAT

Suppose the bold underlined A is changed to a G. If the sequence was then transcribed and translated, what effect would this have?

0%
0%
0%
View this question

Good, very good.

Let's remain with that same sequence, but crank things up a notch.

Image failed to load

Change to a different branched amino acid. (We know which those are, right? ... Right?)

0%
0%
0%
0%
View this question

The following sequence is part of the coding strand of a gene, somewhere in the middle of the open reading frame (i.e. we're already in the correct frame and the initiating codon was upstream of this sequence).

ACTGAAAGAATGATTAATGCTACGGAG

Suppose the the bold underlined G is changed to a T. Once this sequence is then transcribed and translated, what effect will it have?

0%
0%
0%
0%
View this question

OK, so here's that same image again.

Image failed to load

What amino acid is circled? Enter your answer as the full amino acid name. E.g. if you think it's F, then write Phenylalanine.

Note also that nitrogen is blue, oxygen is red. Carbons (in this bit) are green. No hydrogens are shown.

View this question

Here we are again, staring at an amino acid, its backbone emerging from the cartoon of the beta strand like a whale breaching the pristine seas.

Image failed to load

What R group do you see here?

0%
0%
View this question

Let's make it a little trickier with this image:

Image failed to load

Which option is the correct sequence of the three amino acids shown here, in N- to C- direction?

Take your time. Think about where you can look to work out the correct direction through the alpha helix. There's one specific location that gives you everything you need.

View this question

Here's an image from that same protein, zooming in on a beta turn and with four amino acids highlighted in ball and stick representation. I've drawn around one amino acid.

Image failed to load

With respect to the beta turn, which statement describes the circled amino acid?

View this question

Want instant access to all verified answers on learning.monash.edu?

Get Unlimited Answers To Exam Questions - Install Crowdly Extension Now!

Browser

Add to Chrome