logo

Crowdly

Consider the following coding strand of DNA: ATGAGTCAGCATTTAGCTTGA When tran...

✅ The verified answer to this question is available below. Our community-reviewed solutions help you understand the material better.

Consider the following coding strand of DNA:

ATGAGTCAGCATTTAGCTTGA

When translated, a single nucleotide mutation of this sequence would change histidine to the only amino acid that has its R group covalently linked to the backbone nitrogen.

Enter this mutated sequence into the box below.

A translate tool may help you: https://web.expasy.org/translate/

You are permitted to Google the amino acids and codon tables, or refer to your own notes.

(Note: include the entire DNA sequence, not just the region that was changed. For example, if you think the first base should be changed from A to G, then you would paste in GTGAGTCAGCATTTAGCTTGA)

More questions like this

Want instant access to all verified answers on learning.monash.edu?

Get Unlimited Answers To Exam Questions - Install Crowdly Extension Now!