✅ The verified answer to this question is available below. Our community-reviewed solutions help you understand the material better.
Consider the following coding strand of DNA:
ATGAGTCAGCATTTAGCTTGA
When translated, a single nucleotide mutation of this sequence would change histidine to the only amino acid that has its R group covalently linked to the backbone nitrogen.
Enter this mutated sequence into the box below.
A translate tool may help you: https://web.expasy.org/translate/
You are permitted to Google the amino acids and codon tables, or refer to your own notes.
(Note: include the entire DNA sequence, not just the region that was changed. For example, if you think the first base should be changed from A to G, then you would paste in GTGAGTCAGCATTTAGCTTGA)
Get Unlimited Answers To Exam Questions - Install Crowdly Extension Now!