The following sequence is part of the coding strand of a gene, somewhere in the middle of the open reading frame (i.e. we're already i n the correct frame and the initiating codon was upstream of this sequence). ACT G AAAGAATGATTAATGCTACGGAG
Suppose the the bold underlined G is changed to a T . Once this sequence is then transcribed and translated, what effect will it have?

Question

The following sequence is part of the coding strand of a gene, somewhere in the middle of the open reading frame (i.e. we're already  i n the correct frame and the initiating codon was upstream of this sequence). ACT G AAAGAATGATTAATGCTACGGAG 
 Suppose the the bold underlined  G  is changed to a  T . Once this sequence is then transcribed and translated, what effect will it have?

Answer

A positively charged amino acid will be incorporated

Answer

I see what you did there, Nathan

Answer

A negatively charged amino acid will be incorporated

Answer

It will terminate translation

Crowdly

The following sequence is part of the coding strand of a gene, somewhere in the ...

Want instant access to all verified answers on learning.monash.edu?