Шукаєте відповіді та рішення тестів для BCH2011 - Structure and function of cellular biomolecules - S1 2025? Перегляньте нашу велику колекцію перевірених відповідей для BCH2011 - Structure and function of cellular biomolecules - S1 2025 в learning.monash.edu.
Отримайте миттєвий доступ до точних відповідей та детальних пояснень для питань вашого курсу. Наша платформа, створена спільнотою, допомагає студентам досягати успіху!
Who dis?
The image below shows a cartoon representation of the structure of part of a protein.
Because this isn't an exam question, I have crudely labelled these (1 to 4) with my best free-hand mouse skills.
Assign the correct label to each number.
Shown below is data from an experiment assessing the activity of an enzyme following Michaelis-Menten kinetics.
What would the Vmax (in units of micromolar/min) of this reaction be if one third the amount of enzyme had been used for the experiment?
(Note: do not enter any units. You just need to enter in the numerical value, e.g. 15. Obviously the answer isn't 15 or I wouldn't have written that. I guess I could be weird and try to throw you by writing that and having the answer as actually that. But no, I wouldn't do that to you. Plus, you know the answer isn't 15. You've already worked it out and stopped reading this nonsense I'm still typing...)
The following data were obtained in a study of an enzyme and substrate A, known to follow Michaelis-Menten kinetics:
Estimate the Km (in units of micromolar) for the enzyme substrate reaction.
The following data were obtained in a study of an enzyme and substrate A, known to follow Michaelis-Menten kinetics:
Estimate Vmax in units of micromolar/min. You do not need to enter unit, only a value.
Consider the following region of a strand of DNA that, somewhere within, encodes a 119 amino acid protein:
ATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGCTC GCGCTACTCTCTCTTTCTGGCCTGGAGGCTATCCAGCGTACTCCAAAGATTCAGGTTTAC TCACGTCATCCAGCAGAGAATGGAAAGTCAAATTTCCTGAATTGCTATGTGTCTGGGTTT CATCCATCCGACATTGAAGTTGACTTACTGAAGAATGGAGAGAGAATTGAAAAAGTGGAG CATTCAGACTTGTCTTTCAGCAAGGACTGGTCTTTCTATCTCTTGTACTACACTGAATTC ACCCCCACTGAAAAAGATGAGTATGCCTGCCGTGTGAACCATGTGACTTTGTCACAGCCC AAGATAGTTAAGTGGGATCGAGACATGTAAGCAGCATCATGGAGGTTTGAAGATGCCGCA TTTGGATTGGATGAATTCCAAATTCTGCTTGCTTGCTTTTTAATATTGATATGCTTATAC ACTTACACTTTATGCACAAAATGTAGGGTTATAATAATGTTAACATGGACATGATCTTCT TTATAATTCTACTTTGAGTGCTGTCTCCATGTTTGATGTATCTGAGCAGGTTGCTCCACA GGTAGCTCTAGGAGGGCTGGCAACTTAGAGGTGGGGAGCAGAGAATTCTCTTATCCAACA TCAACATCTTGGTCAGATTTGAACTCTTCAATCTCTTGCACTCAAAGCTTGTTAAGATAG TTAAGCGTGCATAAGTTAACTTCCAATTTACATACTCTGCTTAGAATTTGGGGGAAAATT TAGAAATATAATTGACAGGATTATTGGAAATTTGTTATAATGAATGAAACATTTTGTCAT ATAAGATTCATATTTACTTCTTATACATTTGATAAAGTAAGGCATGGTTGTGGTTAATCT GGTTTATTTTTGTTCCACAAGTTAAATAAATCATAAAACTTGA
Design a set of primers that ARE PRECISELY 24 NUCLEOTIDES EACH that would selectively amplify the gene that encodes the 119 amino acid protein.
Enter EITHER of the primers in the box below to check your answer.
(I encourage you to test both, to make sure you got both correctly.)
Make sure you enter them in the 5' to 3' direction, regardless of whether it's the forward or reverse primer. Do not include any additional characters. E.g. if your answer is 5'-AAAAAAAGGGG-3', then just enter AAAAAAAGGGG. (Is that the sound you're making from looking at this question?)
Note: this question is not auto-marked. It's here as a short-answer style question for you to flex your knowledge and writing skills.
Consider the following short polypeptide: MVFLNAEFRWCMNDDPLAVY
Is it possible to precisely predict the mRNA sequence that gave rise to this polypeptide? Provide reasoning for your answer.
Which ONE of the following statements regarding the ribosome is true?
A protein with an isoelectric point (pI) of 5.0 will have a net: