The mRNA sequence below encodes a short polypeptide in the third reading frame, ...
✅ Перевірена відповідь на це питання доступна нижче. Наші рішення, перевірені спільнотою, допомагають краще зрозуміти матеріал.
The mRNA sequence below encodes a short polypeptide in the third reading frame, initiated in the standard manner.
GGACAGUAGUAGUGAUGGGAGAGCGA
What's the amino acid sequence?
(Enter in a sequence using the single amino acid code, e.g. MNATHAN (hint: it's not MNATHAN (that'd be dumb; I wouldn't do that (OK so maybe I would (but not this time (whoah, brackets)))))).
Хочете миттєвий доступ до всіх перевірених відповідей на learning.monash.edu?
Отримайте необмежений доступ до відповідей на екзаменаційні питання - встановіть розширення Crowdly зараз!