✅ Перевірена відповідь на це питання доступна нижче. Наші рішення, перевірені спільнотою, допомагають краще зрозуміти матеріал.
The following sequence is part of the coding strand of a gene, somewhere in the middle of the open reading frame (i.e. we're already in the correct frame and the initiating codon was upstream of this sequence).
TGCCATGCGCGCGGCGAAGAT
Suppose the bold underlined A is changed to a G. If the sequence was then transcribed and translated, what effect would this have?