You've purchased a dried herb labeled as Origanum
vulgare
(oregano) . To confirm its authenticity, you extract a 21-base region of
chloroplast DNA and compare it with standard sequences from oregano and known
adulterant plants.
Genetic
similarity between species or individuals can be assessed by comparing their
DNA sequences—closer matches mean closer biological relationships. DNA sequence from your sample:

5′–TACCGTTGAGCTAGACCTTGA–3′
Standard reference sequences:

Origanum vulgare (oregano): 5′–TACCGTTGAGCTAGACCTAGA–3′

Olea europaea (olive leaf): 5′–TATCGTTGAGCTTGACCTAGA–3′

Rhus coriaria (sumac): 5′–TACCGCTGAGCTAGACCTTGA–3′

Myrtus communis (myrtle): 5′–TACCGTTGAGCTAGTCCTTGA–3′ Which of the following is the most accurate conclusion regarding the species identity of your herb sample?

Question

You've purchased a dried herb labeled as  Origanum
vulgare
(oregano) . To confirm its authenticity, you extract a 21-base region of
chloroplast DNA and compare it with standard sequences from oregano and known
adulterant plants.
Genetic
similarity between species or individuals can be assessed by comparing their
DNA sequences—closer matches mean closer biological relationships.  DNA sequence from your sample: 
 
5′–TACCGTTGAGCTAGACCTTGA–3′ 
 Standard reference sequences:

Origanum vulgare  (oregano): 5′–TACCGTTGAGCTAGACCTAGA–3′

Olea europaea  (olive leaf): 5′–TATCGTTGAGCTTGACCTAGA–3′

Rhus coriaria  (sumac): 5′–TACCGCTGAGCTAGACCTTGA–3′

Myrtus communis  (myrtle): 5′–TACCGTTGAGCTAGTCCTTGA–3′ Which of the following is the  most accurate  conclusion regarding the species identity of your herb sample?

Accepted Answer

The sample differs from all reference species by 1 or more bases, making the test inconclusive for species identification.

Answer

The sample differs from  O. vulgare  by 1 base and from all others by 2 or more bases, suggesting the herb is most likely authentic oregano.

Answer

The sample is an exact match with  Rhus coriaria  and differs from  O. vulgare  by 1 base, indicating probable substitution with sumac.

Answer

The sample matches  Olea europaea  (olive) most closely, with only 1 base mismatch, indicating likely adulteration with olive leaf.

Answer

The sample matches  Myrtus communis  perfectly, while differing from oregano by 2 bases, suggesting substitution with myrtle.

Answer

The sample differs by at least 2 bases from all known reference sequences, implying it may contain an unidentified or hybrid species.

Crowdly

You've purchased a dried herb labeled as Origanum vulgare (oregano) . To co...

Want instant access to all verified answers on dle.plaksha.edu.in?