Looking for Natures Machines test answers and solutions? Browse our comprehensive collection of verified answers for Natures Machines at dle.plaksha.edu.in.
Get instant access to accurate answers and detailed explanations for your course questions. Our community-driven platform helps students succeed!
Inset (a) shows the action potential in a neuron and inset (b) shows the action potential in a cardiac muscle. Inset (c) shows the action potential in a cardiac muscle (same as inset (b)) along with the corresponding flow of ions. Choose the correct answer(s).
P.S: This is a multi-select question, but each incorrect answer has a negative marking of 0.25 marks.
We learnt about the "central dogma" of molecular biology:
(a) Each of the three processes - replication, transcription and translation - involves a machinery with several entities participating. For each process, name the molecular machine that plays a critical and major role in that process, and state within one sentence the function of each of them.
(b) Errors made during DNA replication are far lesser compared to errors made during transcription. Why does it make sense that replication is more accurate than transcription?
Keep the answers short and to the point!The image on the left shows human performance due to our muscles and the image on the right shows the internal combustion engine of a vehicle.
Compare the two systems in terms of: i) what similar aspect justify them as machines, ii) how does the stability/life-time of these engines differ, in terms of wear and tear, and from a fundamental perspective, why do you think this difference exists?
(Hint: In other words, one crucial point of similarity and difference between the two machine systems needs to be explained). Keep it short.
Given the following prokaryotic mRNA molecule:
5′ AUGUUGCGCACGUAC 3′
Assuming the ribosome binds at the 5′ end and translation begins at the first start codon, what would be the correct amino acid sequence of the polypeptide translated from this mRNA?
NOTE: This question has a negative marking of 0.25 marks.
A mutation in a eukaryotic cell line prevents the addition of a 5′ cap to pre-mRNA transcripts. Which of the following is the most likely consequence of this mutation based on the mRNA structure and function shown in the image?
You've purchased a dried herb labeled as Origanum vulgare (oregano) . To confirm its authenticity, you extract a 21-base region of chloroplast DNA and compare it with standard sequences from oregano and known adulterant plants. Genetic similarity between species or individuals can be assessed by comparing their DNA sequences—closer matches mean closer biological relationships.
DNA sequence from your sample: 5′–TACCGTTGAGCTAGACCTTGA–3′
Standard reference sequences:
Origanum vulgare (oregano): 5′–TACCGTTGAGCTAGACCTAGA–3′
Olea europaea (olive leaf): 5′–TATCGTTGAGCTTGACCTAGA–3′
Rhus coriaria (sumac): 5′–TACCGCTGAGCTAGACCTTGA–3′
Myrtus communis (myrtle): 5′–TACCGTTGAGCTAGTCCTTGA–3′
A researcher is analyzing a synthetic DNA double helix composed of 100 base pairs, with a significantly higher proportion of A–T pairs than G–C pairs.
Using the structural information shown in the image, which of the following statements most accurately describes the likely outcome regarding the molecule’s stability and length?
Glucose (C₆H₁₂O₆) is the monomeric unit of several important polysaccharides, including starch, glycogen, and cellulose—each having distinct linkages and biological functions, as shown in the image. When 10 glucose monomers join via dehydration synthesis to form a polysaccharide chain, water is lost during bond formation.
Which of the following statements is most accurate in explaining the relationship between polymerization and structure-function in these glucose-based polymers?