The velocity of each of these reactions:

The mRNA sequence below encodes a short polypeptide in the third reading frame, initiated in the standard manner.

GGACAGUAGUAGUGAUGGGAGAGCGA

What's the amino acid sequence?

(Enter in a sequence using the single amino acid code, e.g. MNATHAN (hint: it's not MNATHAN (that'd be dumb; I wouldn't do that (OK so maybe I would (but not this time (whoah, brackets)))))).

OK, so here's another one. See if you can do this one without using the Expasy Translate Tool that we used in the workshop.

The sequences below are all template strands. One of them is used as a template to make mRNA that can then be read by the ribosome to produce the tripeptide MetProTrp.

Which sequence is it?

(Oh, and I've been sneaky: all sequences are written 5'-3'. Sorry not sorry.)

Oh look, it's the same sequence again.

Suppose that an A was introduced after codon 2 but before codon 3.

Suppose also that the final nucleotide of codon 4 was deleted.

Which statement below is true?

Shown below are the sequences of two strands that are adjacent to each other in an antiparallel β-sheet.

The strands are labelled “A” and “B” and the amino acids are labelled A1-A2-A3…A8 and B1-B2-B3…B8 so that we can unambiguously refer to each amino acid.

The side chains of amino acids Asp-A3 and Lys-B6 (underlined) form a salt bridge on one face of the β-sheet.

Rotation around the bonds of which atom of the peptide backbone allows for secondary structure to arise?

Shown below is a ribbon representation of a protein.

The structure below is the phospholipid phosphatidylcholine.

Identify each labelled region.

Consider the following coding strand of a DNA duplex:

5'-CAAACGGAGC-3'

Write out the sequence of the corresponding non-coding strand in the 5' to 3' orientation.

Be careful not to type any spaces or additional characters. For example, if you think the answer is 5'-AGCC-3', simply type AGCC.

Consider the following coding strand of a DNA duplex:

5'-AGGACTTGAA-3'

Write out the sequence of the corresponding non-coding strand in the 3' to 5' orientation.

Be careful not to type any spaces or additional characters. For example, if you think the answer is 3'-AGCC-5', simply type AGCC.