Шукаєте відповіді та рішення тестів для BCH2011 - Structure and function of cellular biomolecules - S1 2025? Перегляньте нашу велику колекцію перевірених відповідей для BCH2011 - Structure and function of cellular biomolecules - S1 2025 в learning.monash.edu.
Отримайте миттєвий доступ до точних відповідей та детальних пояснень для питань вашого курсу. Наша платформа, створена спільнотою, допомагає студентам досягати успіху!
In your excitement, you lost track of things and you only scribbled down one strand of DNA in your lab notebook:
5'-CCAATCCGCAATGCAATTTACCTGTTTCCGCCACTGTACTCAGTAGTAGGA-3'
Relative to the sequence shown, which strand (forward (i.e. the one shown), or reverse) and which reading frame (1, 2 or 3) is the peptide encoded within?
(As a skilled biochemist, you may use any tools at your disposal!)In a rare discovery, you think you have discovered a gene sequence that, when translated, results in a peptide that holds the secret to immortality!
When translated, you felt sure the encoded peptide could be the secret to immortality!
In your excitement, you lost track of things and you only scribbled down one strand of DNA in your lab notebook:
5'-TACGGATTCAGGTAGCTGCTAGGCAAGACTGAAATTTTGACATCGGTTCA-3'
Relative to the sequence shown, which strand (forward (i.e. the one shown), or reverse) and which reading frame (1, 2 or 3) is the peptide encoded within?
(As a skilled biochemist, you may use any tools at your disposal!)Consider the following coding strand of DNA:
ATGAGTCAGCATTTAGCTTGA
When translated, a single nucleotide mutation of this sequence would change histidine to the only amino acid that has its R group covalently linked to the backbone nitrogen.
Enter this mutated sequence into the box below.
A translate tool may help you: https://web.expasy.org/translate/
You are permitted to Google the amino acids and codon tables, or refer to your own notes.
(Note: include the entire DNA sequence, not just the region that was changed. For example, if you think the first base should be changed from A to G, then you would paste in GTGAGTCAGCATTTAGCTTGA)
Q7. Which of the two proteins do you expect to elute first from the Sephadex G100 column?
Q6. What are the molecular weights of the two proteins to be separated in the BCH2011 lab 4 experiment?
Q5. What are the two proteins to be separated in the BCH2011 lab 4 experiment?
The column matrix is composed of cross-linked polymers with pores of selected sizes. Smaller molecules can enter the pores in the polymer beads from which larger molecules are excluded. Small molecules therefore have a larger three-dimensional space in which to diffuse, making their path through the column longer. Larger molecules migrate faster because they pass directly through the column, unhindered by the bead pores. B+D are outside of the separation range of the beads and elute together in the initial void volume. C and F are too small to be resolved by the beads and elute together at the end.
Q3. If a mixture of five proteins within the molecular weights listed below was applied to a Sephadex G100 column what would the order of elution be?
Protein A: 13,000Protein B: 190,000Protein C: 2,000Protein D: 450,000Protein E: 68,500Protein F: 1,800
Ion exchange chromatography separates proteins according to their net charge. Why is pH an important consideration during this technique?
Consider that you wish to separate a mixture of histidine, serine and aspartate by ion exchange chromatography.
Using a cation exchange column at pH 5, which amino acid would you expect to elute first and which last?
pKa and pI values are as follows:
Histidine: pK1 = 1.82, pK2 = 9.17, pKR = 6.00, pI = 7.59
Serine: pK1 = 2.21, pK2 = 9.15, pI = 5.68
Aspartate: pK1 = 1.88, pK2 = 9.60, pKR = 3.65, pI = 2.77