Шукаєте відповіді та рішення тестів для BCH2011 - Structure and function of cellular biomolecules - S1 2025? Перегляньте нашу велику колекцію перевірених відповідей для BCH2011 - Structure and function of cellular biomolecules - S1 2025 в learning.monash.edu.
Отримайте миттєвий доступ до точних відповідей та детальних пояснень для питань вашого курсу. Наша платформа, створена спільнотою, допомагає студентам досягати успіху!
Why is the genetic code referred to as degenerate?
The image below shows the three main sites -- E, P and A -- of the ribosome involved in the process of translation.
A new inhibitor of translation has been found that occupies the "E" site.
What specific effect would this have on translation?
Using your knowledge of the genetic code and the image below, which ONE of the following amino acid replacements can be caused by a single nucleotide change?
Consider the following tripeptide:
Val-Gln-Asn
In the box below, enter a minimal DNA sequence (coding strand), written 5'-to-3', that could give rise to this peptide. Do not include an initiating codon at the start. Please just enter in the codons for the given peptide above.
(You should only include nucleotides in your answer, e.g. AAAA... Do not include 5' or 3', spaces, or any other non-nucleotide characters.)
Consider the following coding strand DNA sequence, written 5'-to-3':
GTTGCTTTAATTGAC
If this sequence were to be directly translated from the first base, what is the amino acid sequence (in single letter code) that would arise?
(Your answer should only include single-letter amino acids. Do not include spaces or other non-amino acid characters.)
In your excitement, you lost track of things and you only scribbled down one strand of DNA in your lab notebook:
5'-TTTCAGATCATGTGAGTTCCTTGAAACTTTGACGCTTTGGCTCTCATTACC-3'
Relative to the sequence shown, which strand (forward (i.e. the one shown), or reverse) and which reading frame (1, 2 or 3) is the peptide encoded within?
(As a skilled biochemist, you may use any tools at your disposal!)Consider the following coding strand of DNA:
ATGGGCCAGAAATTAGAGTGA
When translated, a single nucleotide mutation of this sequence would result in a negatively charged amino acid being changed to the amino acid with a methyl (-CH3) group as its side chain.
Enter this mutated sequence into the box below.
A translate tool may help you: https://web.expasy.org/translate/
You are permitted to Google the amino acids and codon tables, or refer to your own notes.
(Note: include the entire DNA sequence, not just the region that was changed. For example, if you think the first base should be changed from A to G, then you would paste in GTGGGCCAGAAATTAGAGTGA)