Looking for MCB2011 - Molecular biology and the cell - S1 2026 test answers and solutions? Browse our comprehensive collection of verified answers for MCB2011 - Molecular biology and the cell - S1 2026 at learning.monash.edu.
Get instant access to accurate answers and detailed explanations for your course questions. Our community-driven platform helps students succeed!
The researcher designs a forward and reverse primer pair that specifically binds to DNA sequences flanking exon 7 of the APC gene. The primer nucleotide sequences are provided in Table 2.
Table 2. Forward and reverse primer nucleotide sequences
| Primer | Nucleotide sequence (5′→3′) |
|---|---|
| Forward primer | GCCTTGGGCTAAGAAAGCCTA |
| Reverse primer | CAGCACATTGGTACTGAATGCTT |
Q3. Use the equation listed below to calculate and record the melting temperature (Tm) of the forward and reverse primers. Record the Tm to the nearest whole number. (2 marks)
Tm (°C) = 69.4 + (0.41x(%GC)) - (650/N)
Q5. Select a suitable annealing temperature for the PCR reaction.
Samples of the tumour tissue and adjacent normal colon tissue were also sent to a biomedical researcher to investigate the genetic basis of the patient’s colorectal cancer. DNA was extracted from both the colorectal tumour tissue and the normal colon tissue using a silica column-based method. UV-Vis spectrophotometry was used to assess the concentration and purity of the extracted DNA. The spectrophotometric results for the colorectal tumour tissue are shown in Table 1.
Table 1. Spectrophotometric assessment of DNA extracted from colorectal tumour tissue.
| Measurement | Result |
|---|---|
| dsDNA concentration | 40 ng/µL |
| Absorbance (230 nm) | 0.40 |
| Absorbance (260 nm) | 0.76 |
| Absorbance (280 nm) | 0.42 |
Q2. Use the values provided in Table 1 to calculate the 260/230 and 260/280 absorbance ratios for the DNA extracted from colorectal tumour tissue. Evaluate whether each ratio falls within the expected range for pure DNA. If a ratio falls outside the expected range, identify the most likely contaminant. (2-3 sentences) (3 marks)
The import of acyl-CoA dehydrogenase into the mitochondrion is defective in cell line HEP-M1. The researcher used subcellular fractionation and western blotting to detect acyl-CoA dehydrogenase in different subcellular compartments. The western blotting results for normal healthy hepatocytes and the HEP-M1 cell line are summarised in the figure below.
Which of the following mutations (A, B, C) is most likely present in the HEP-M1 cell line? Use the western blotting results and your knowledge of the mitochondrial protein import process to justify your response. (2-3 sentences) (2 marks)
A. The acyl-CoA dehydrogenase mitochondrial signal sequence is mutated B. The receptor protein in the TOM complex is mutated C. The translocation channel in the TIM23 complex is mutated
The import of acyl-CoA dehydrogenase into the mitochondrion is defective in cell line HEP-M1. The researcher used subcellular fractionation and western blotting to detect acyl-CoA dehydrogenase in different subcellular compartments. The western blotting results for normal healthy hepatocytes and the HEP-M1 cell line are summarised in the figure below.
Which of the following mutations (A, B, C) is most likely present in the HEP-M1 cell line? Use the western blotting results and your knowledge of the mitochondrial protein import process to justify your response. (2-3 sentences) (2 marks)
A. The acyl-CoA dehydrogenase mitochondrial signal sequence is mutated B. The receptor protein in the TOM complex is mutated C. The translocation channel in the TIM23 complex is mutated
In the week ten laboratory class the mitochondrial networks of wild-type and patient-derived fibroblasts were visualised using fluorescent staining and microscopy. The expected results for the wild-type fibroblasts (well #1) and patient-derived fibroblasts (well #2) are shown in Figure 1 and are available in the week ten real-time section on Moodle. Complete Tasks A-B below to upload and interpret your results.
Figure 1. Expected fluorescence staining patterns for wild-type (#1) and patient-derived (#2) fibroblasts labelled with Streptavidin AF594 (red), Phalloidin AF488 (green), and DAPI (blue).
A) Results Upload: Upload an overlay fluorescence image (DAPI + GFP + Texas Red) showing your results for both the wild-type fibroblasts (well #1) and the patient-derived fibroblasts (well #2). Present both images in a single file (Word or PowerPoint) and ensure that each image is clearly labelled with the cell line (wild-type or patient) and corresponding well number (#1 or #2).
B) Fluorescent Signals: If the fluorescent staining procedure was successful, fluorescent signals should be visible in all three channels (DAPI, GFP, and Texas Red), as shown in Figure 1. Examine your experimental results. Did you successfully detect fluorescent signals in both the wild-type and patient-derived fibroblasts for all three fluorescent dyes (Streptavidin AF594, Phalloidin AF488, and DAPI)? (YES/NO) (4 marks)
If YES, proceed to the next question. (Q3)
If NO, identify which fluorescent dye(s) did not successfully produce a signal and suggest one or more possible sources of error or procedural issues that could explain this result.
In the week ten laboratory class the mitochondrial networks of wild-type and patient-derived fibroblasts were visualised using fluorescent staining and microscopy. The expected results for the wild-type fibroblasts (well #1) and patient-derived fibroblasts (well #2) are shown in Figure 1 and are available in the week ten real-time section on Moodle. Complete Tasks A-B below to upload and interpret your results.
Figure 1. Expected fluorescence staining patterns for wild-type (#1) and patient-derived (#2) fibroblasts labelled with Streptavidin AF594 (red), Phalloidin AF488 (green), and DAPI (blue).
A) Results Upload: Upload an overlay fluorescence image (DAPI + GFP + Texas Red) showing your results for both the wild-type fibroblasts (well #1) and the patient-derived fibroblasts (well #2). Present both images in a single file (Word or PowerPoint) and ensure that each image is clearly labelled with the cell line (wild-type or patient) and corresponding well number (#1 or #2).
B) Fluorescent Signals: If the fluorescent staining procedure was successful, fluorescent signals should be visible in all three channels (DAPI, GFP, and Texas Red), as shown in Figure 1. Examine your experimental results. Did you successfully detect fluorescent signals in both the wild-type and patient-derived fibroblasts for all three fluorescent dyes (Streptavidin AF594, Phalloidin AF488, and DAPI)? (YES/NO) (4 marks)
If YES, proceed to the next question. (Q3)
If NO, identify which fluorescent dye(s) did not successfully produce a signal and suggest one or more possible sources of error or procedural issues that could explain this result.
In the week ten laboratory class the mitochondrial networks of wild-type and patient-derived fibroblasts were visualised using fluorescent staining and microscopy. The expected results for the wild-type fibroblasts (well #1) and patient-derived fibroblasts (well #2) are shown in Figure 1 and are available in the week ten real-time section on Moodle. Complete Tasks A-B below to upload and interpret your results.
Figure 1. Expected fluorescence staining patterns for wild-type (#1) and patient-derived (#2) fibroblasts labelled with Streptavidin AF594 (red), Phalloidin AF488 (green), and DAPI (blue).
A) Results Upload: Upload an overlay fluorescence image (DAPI + GFP + Texas Red) showing your results for both the wild-type fibroblasts (well #1) and the patient-derived fibroblasts (well #2). Present both images in a single file (Word or PowerPoint) and ensure that each image is clearly labelled with the cell line (wild-type or patient) and corresponding well number (#1 or #2).
B) Fluorescent Signals: If the fluorescent staining procedure was successful, fluorescent signals should be visible in all three channels (DAPI, GFP, and Texas Red), as shown in Figure 1. Examine your experimental results. Did you successfully detect fluorescent signals in both the wild-type and patient-derived fibroblasts for all three fluorescent dyes (Streptavidin AF594, Phalloidin AF488, and DAPI)? (YES/NO) (4 marks)
If YES, proceed to the next question. (Q3)
If NO, identify which fluorescent dye(s) did not successfully produce a signal and suggest one or more possible sources of error or procedural issues that could explain this result.
In the week ten laboratory class the mitochondrial networks of wild-type and patient-derived fibroblasts were visualised using fluorescent staining and microscopy. The expected results for the wild-type fibroblasts (well #1) and patient-derived fibroblasts (well #2) are shown in Figure 1 and are available in the week ten real-time section on Moodle. Complete Tasks A-B below to upload and interpret your results.
Figure 1. Expected fluorescence staining patterns for wild-type (#1) and patient-derived (#2) fibroblasts labelled with Streptavidin AF594 (red), Phalloidin AF488 (green), and DAPI (blue).
A) Results Upload: Upload an overlay fluorescence image (DAPI + GFP + Texas Red) showing your results for both the wild-type fibroblasts (well #1) and the patient-derived fibroblasts (well #2). Present both images in a single file (Word or PowerPoint) and ensure that each image is clearly labelled with the cell line (wild-type or patient) and corresponding well number (#1 or #2).
B) Fluorescent Signals: If the fluorescent staining procedure was successful, fluorescent signals should be visible in all three channels (DAPI, GFP, and Texas Red), as shown in Figure 1. Examine your experimental results. Did you successfully detect fluorescent signals in both the wild-type and patient-derived fibroblasts for all three fluorescent dyes (Streptavidin AF594, Phalloidin AF488, and DAPI)? (YES/NO) (4 marks)
If YES, proceed to the next question. (Q3)
If NO, identify which fluorescent dye(s) did not successfully produce a signal and suggest one or more possible sources of error or procedural issues that could explain this result.
Explain how the sequence variant identified in the patient leads to the mitochondrial morphology observed in their fibroblasts. In your answer, describe the sequence variant at the DNA level, its effect on the MFN2 protein, and the resulting impact on mitochondrial fusion and mitochondrial network structure. Also comment on how these cellular changes may contribute to the patient’s clinical presentation. (4-5 sentences) (5 marks)