logo

Crowdly

Browser

Додати до Chrome

BCH2011 - Structure and function of cellular biomolecules - S1 2025

Шукаєте відповіді та рішення тестів для BCH2011 - Structure and function of cellular biomolecules - S1 2025? Перегляньте нашу велику колекцію перевірених відповідей для BCH2011 - Structure and function of cellular biomolecules - S1 2025 в learning.monash.edu.

Отримайте миттєвий доступ до точних відповідей та детальних пояснень для питань вашого курсу. Наша платформа, створена спільнотою, допомагає студентам досягати успіху!

In the process of revising for BCH2011, you fell asleep (understandable) but upon awakening you realised you dreamt of the titration of an amino acid side chain (understandable). The details of the dream are murky, but you recall it looking something like this:

Image failed to load

What is the pKa of the side chain and which amino acid were you dreaming of?

0%
0%
0%
0%
0%
0%
0%
Переглянути це питання

The data below shows four different protein unfolding curves for the same protein but containing various mutations.

Image failed to load

The protein is 280 amino acids long. The N-terminal region of the protein involves a cluster of hydrophobic amino acids critical for stabilising the overall structure of the protein. The C-terminal region contains a solvent-exposed pocket containing charged amino acids that, whilst not so critical for protein folding, play an important role in the protein's function.

The mutations studied were as follows:

  • R247K
  • F38V
  • F38A

The wild-type (WT) version of the protein has been extensively studied and no mutation has ever been found that has improved stability.

Which condition corresponds to which version of the protein?

Переглянути це питання

Let's start easy with something easy.

Here's a coding strand sequence, with each codon helpfully spaced by spaces and each codon numbered by numbers and with me writing more words than are necessary as some introductory text.

Image failed to load

Spot the stop.

0%
0%
0%
Переглянути це питання

The following sequence is part of the coding strand of a gene, somewhere in the middle of the open reading frame (i.e. we're already in the correct frame and the initiating codon was upstream of this sequence).

TGCCATGCGCGCGGCGAAGAT

Suppose the bold underlined A is changed to a G. If the sequence was then transcribed and translated, what effect would this have?

0%
0%
0%
Переглянути це питання

Good, very good.

Let's remain with that same sequence, but crank things up a notch.

Image failed to load

Change to a different branched amino acid. (We know which those are, right? ... Right?)

0%
0%
0%
0%
Переглянути це питання

The following sequence is part of the coding strand of a gene, somewhere in the middle of the open reading frame (i.e. we're already in the correct frame and the initiating codon was upstream of this sequence).

ACTGAAAGAATGATTAATGCTACGGAG

Suppose the the bold underlined G is changed to a T. Once this sequence is then transcribed and translated, what effect will it have?

0%
0%
0%
0%
Переглянути це питання

OK, so here's that same image again.

Image failed to load

What amino acid is circled? Enter your answer as the full amino acid name. E.g. if you think it's F, then write Phenylalanine.

Note also that nitrogen is blue, oxygen is red. Carbons (in this bit) are green. No hydrogens are shown.

Переглянути це питання

Here we are again, staring at an amino acid, its backbone emerging from the cartoon of the beta strand like a whale breaching the pristine seas.

Image failed to load

What R group do you see here?

0%
0%
Переглянути це питання

Let's make it a little trickier with this image:

Image failed to load

Which option is the correct sequence of the three amino acids shown here, in N- to C- direction?

Take your time. Think about where you can look to work out the correct direction through the alpha helix. There's one specific location that gives you everything you need.

Переглянути це питання

Here's an image from that same protein, zooming in on a beta turn and with four amino acids highlighted in ball and stick representation. I've drawn around one amino acid.

Image failed to load

With respect to the beta turn, which statement describes the circled amino acid?

Переглянути це питання

Хочете миттєвий доступ до всіх перевірених відповідей на learning.monash.edu?

Отримайте необмежений доступ до відповідей на екзаменаційні питання - встановіть розширення Crowdly зараз!

Browser

Додати до Chrome