Шукаєте відповіді та рішення тестів для BCH2011 - Structure and function of cellular biomolecules - S1 2025? Перегляньте нашу велику колекцію перевірених відповідей для BCH2011 - Structure and function of cellular biomolecules - S1 2025 в learning.monash.edu.
Отримайте миттєвий доступ до точних відповідей та детальних пояснень для питань вашого курсу. Наша платформа, створена спільнотою, допомагає студентам досягати успіху!
Hi, I'm a tRNA and my anti-codon is 5'-CAA-3'
What amino acid do I LOVE to bring into the ribosome?
The data below shows four different protein unfolding curves for the same protein but containing various mutations.
The protein is 280 amino acids long. The N-terminal region of the protein involves a cluster of hydrophobic amino acids critical for stabilising the overall structure of the protein. The C-terminal region contains a solvent-exposed pocket containing charged amino acids that, whilst not so critical for protein folding, play an important role in the protein's function.
The mutations studied were as follows:
The wild-type (WT) version of the protein has been extensively studied and no mutation has ever been found that has improved stability.
Which condition corresponds to which version of the protein?
The following sequence is part of the coding strand of a gene, somewhere in the middle of the open reading frame (i.e. we're already in the correct frame and the initiating codon was upstream of this sequence).
TGCCATGCGCGCGGCGAAGAT
Suppose the bold underlined A is changed to a G. If the sequence was then transcribed and translated, what effect would this have?
Good, very good.
Let's remain with that same sequence, but crank things up a notch.
Change to a different branched amino acid. (We know which those are, right? ... Right?)
Let's start easy with something easy.
Here's a coding strand sequence, with each codon helpfully spaced by spaces and each codon numbered by numbers and with me writing more words than are necessary as some introductory text.
Spot the stop.
The following sequence is part of the coding strand of a gene, somewhere in the middle of the open reading frame (i.e. we're already in the correct frame and the initiating codon was upstream of this sequence).
ACTGAAAGAATGATTAATGCTACGGAG
Suppose the the bold underlined G is changed to a T. Once this sequence is then transcribed and translated, what effect will it have?
Here we are again, staring at an amino acid, its backbone emerging from the cartoon of the beta strand like a whale breaching the pristine seas.
What R group do you see here?
OK, so here's that same image again.
What amino acid is circled? Enter your answer as the full amino acid name. E.g. if you think it's F, then write Phenylalanine.
Note also that nitrogen is blue, oxygen is red. Carbons (in this bit) are green. No hydrogens are shown.
Here's an image from that same protein, zooming in on a beta turn and with four amino acids highlighted in ball and stick representation. I've drawn around one amino acid.
With respect to the beta turn, which statement describes the circled amino acid?
Let's make it a little trickier with this image:
Which option is the correct sequence of the three amino acids shown here, in N- to C- direction?
Take your time. Think about where you can look to work out the correct direction through the alpha helix. There's one specific location that gives you everything you need.