Crowdly

Add to Chrome

Natures Machines

Looking for Natures Machines test answers and solutions? Browse our comprehensive collection of verified answers for Natures Machines at dle.plaksha.edu.in.

Get instant access to accurate answers and detailed explanations for your course questions. Our community-driven platform helps students succeed!

The diagram shows the membrane potential changes during an action potential (left) and associated ionic movements and channel states (right). Based on your understanding of neuronal physiology, select all correct statements:

P.S: This is a multi-select question, but each incorrect answer has a negative marking of 0.25 marks.

During the rising phase of the action potential, voltage-gated Na⁺ channels are open and Na⁺ ions enter the neuron.

During the absolute refractory period, another action potential can be generated, but only with a larger-than-normal stimulus.

The membrane potential at the peak of the action potential approaches closer to the equilibrium potential of Na⁺, as Na⁺ permeability is highest at that point.

Hyperpolarization is only dependent on the inactivation loop of sodium channels, which allows excess K⁺ to exit the cell beyond the resting potential level.

The sodium-potassium pump (Na⁺/K⁺ ATPase) is responsible for returning the membrane to resting potential post hyperpolarization.

The repolarization phase is primarily due to the opening of voltage-gated Na⁺ channels and the influx of Na⁺ ions into the cell.

View this question

The image on the left shows human performance due to our muscles and the image on the right shows the internal combustion engine of a vehicle.

Compare the two systems in terms of: i) what similar aspect justify them as machines, ii) how does the stability/life-time of these engines differ, in terms of wear and tear, and from a fundamental perspective, why do you think this difference exists?

(Hint: In other words, one crucial point of similarity and difference between the two machine systems needs to be explained). Keep it short.

View this question

Inset (a) shows the action potential in a neuron and inset (b) shows the action potential in a cardiac muscle. Inset (c) shows the action potential in a cardiac muscle (same as inset (b)) along with the corresponding flow of ions. Choose the correct answer(s).

P.S: This is a multi-select question, but each incorrect answer has a negative marking of 0.25 marks.

Cardiac action potentials have a plateau phase, while neuronal action potentials do not.

The resting potential of the cardiac muscle has a higher magnitude than the resting potential of the neuron

The action potential of a neuron is considerably shorter in duration than the action potential of the cardiac muscle

Sodium ions play no role in the depolarization of the action potential shown in inset (b).

The refractory period in the action potential shown in inset (a) is due to the efflux of potassium ions and an influx of calcium ions.

View this question

Given the following prokaryotic mRNA molecule:

5′ AUGUUGCGCACGUAC 3′

Assuming the ribosome binds at the 5′ end and translation begins at the first start codon, what would be the correct amino acid sequence of the polypeptide translated from this mRNA?

NOTE: This question has a negative marking of 0.25 marks.

Met – Cys – Ala – Arg – Tyr

❌

Met – Leu – Arg – His – Tyr

❌

Translation cannot be initiated

❌

Met – Val – Ala – Pro – Tyr

❌

Met – Leu – Arg – Thr – Tyr

✅

Met – Leu – Ala – His – Stop

❌

View this question

We learnt about the "central dogma" of molecular biology:

Image failed to load

(a) Each of the three processes - replication, transcription and translation - involves a machinery with several entities participating. For each process, name the molecular machine that plays a critical and major role in that process, and state within one sentence the function of each of them.

(b) Errors made during DNA replication are far lesser compared to errors made during transcription. Why does it make sense that replication is more accurate than transcription?

Keep the answers short and to the point!

View this question

A researcher is analyzing a synthetic DNA double helix composed of 100 base pairs, with a significantly higher proportion of A–T pairs than G–C pairs.

Using the structural information shown in the image, which of the following statements most accurately describes the likely outcome regarding the molecule’s stability and length?

The DNA will be 10 nm long and highly stable due to tight packing of A–T base pairs forming three hydrogen bonds per pair.

The number of base pairs does not affect DNA length, but fewer G–C bonds will increase the distance between the strands, making it longer than 34 nm.

The DNA molecule will complete 10 helical turns and measure approximately 34 nm in length; the A–T enrichment will make it more stable due to fewer hydrogen bonds.

❌

The total length of the molecule will be 100 nm; however, instability will arise because of the directionality mismatch from excessive A–T content.

The DNA molecule will be 34 nm long with 10 helical turns; however, the dominance of A–T base pairs (with only 2 hydrogen bonds) will reduce its thermal stability.

Because the base spacing is 3.4 nm per pair, the total DNA length will be 340 nm and highly unstable due to sugar-phosphate backbone misalignment.

View this question

A mutation in a eukaryotic cell line prevents the addition of a 5′ cap to pre-mRNA transcripts. Which of the following is the most likely consequence of this mutation based on the mRNA structure and function shown in the image?

The protein-coding region of the mRNA will be extended, producing a longer-than-normal polypeptide.

❌

The mRNA will degrade quickly in the cytoplasm and will not be efficiently translated due to loss of protection and ribosome binding signals.

✅

The mRNA will lack a start codon and therefore will not be recognized by the ribosome.

❌

The absence of the 5′ cap will result in incomplete splicing of introns during transcription.

❌

The resulting mRNA will be translated more efficiently since the ribosome binds directly to the poly-A tail instead.

❌

View this question

You've purchased a dried herb labeled as

Origanum

vulgare

(oregano)

. To confirm its authenticity, you extract a 21-base region of

chloroplast DNA and compare it with standard sequences from oregano and known

adulterant plants.

Genetic

similarity between species or individuals can be assessed by comparing their

DNA sequences—closer matches mean closer biological relationships.

DNA sequence from your sample:

5′–TACCGTTGAGCTAGACCTTGA–3′

Standard reference sequences:

Origanum vulgare (oregano): 5′–TACCGTTGAGCTAGACCTAGA–3′

Olea europaea (olive leaf): 5′–TATCGTTGAGCTTGACCTAGA–3′

Rhus coriaria (sumac): 5′–TACCGCTGAGCTAGACCTTGA–3′

Myrtus communis (myrtle): 5′–TACCGTTGAGCTAGTCCTTGA–3′

Which of the following is the most accurate conclusion regarding the species identity of your herb sample?

The sample differs from O. vulgare by 1 base and from all others by 2 or more bases, suggesting the herb is most likely authentic oregano.

❌

The sample is an exact match with Rhus coriaria and differs from O. vulgare by 1 base, indicating probable substitution with sumac.

❌

The sample matches Olea europaea (olive) most closely, with only 1 base mismatch, indicating likely adulteration with olive leaf.

❌

The sample differs from all reference species by 1 or more bases, making the test inconclusive for species identification.

✅

The sample matches Myrtus communis perfectly, while differing from oregano by 2 bases, suggesting substitution with myrtle.

❌

The sample differs by at least 2 bases from all known reference sequences, implying it may contain an unidentified or hybrid species.

❌

View this question

Which of the following correctly identifies the biomolecules corresponding to Samples A, B, and C?

NOTE: This question has a negative marking of 0.25 marks.

A = DNA, B = Polysaccharide, C = Protein

❌

A = Polysaccharide, B = DNA, C = Protein

❌

A = DNA, B = Protein, C = Polysaccharide

❌

The information is insufficient to make a conclusion.

❌

A = Polysaccharide, B = Protein, C = DNA

✅

A = Protein, B = DNA, C = Polysaccharide

❌

View this question

Glucose (C₆H₁₂O₆) is the monomeric unit of several important polysaccharides, including starch, glycogen, and cellulose—each having distinct linkages and biological functions, as shown in the image. When 10 glucose monomers join via dehydration synthesis to form a polysaccharide chain, water is lost during bond formation.

Which of the following statements is most accurate in explaining the relationship between polymerization and structure-function in these glucose-based polymers?

Dehydration reactions only occur in nucleic acids and proteins, not in polysaccharides like those shown in the image.

❌

When 10 glucose molecules combine to form a branched amylopectin segment, the molecular formula is C₆₀H₁₂₀O₆₀ due to addition of oxygen atoms at branch points.

❌

In glycogen, α glycosidic bonds consume no water during polymerization, so the molecular formula of a 10-unit chain remains C₆₀H₁₂₀O₆₀.

❌

The molecular formula of a polymer formed by linking 10 glucose units through 9 glycosidic bonds is C₆₀H₁₀₂O₅₁, and if these bonds are α glycosidic, the resulting polymer is cellulose with structural rigidity due to hydrogen bonding between parallel chains.

❌

Cellulose and glycogen differ in molecular formula because cellulose has more glucose units per branch, altering the ratio of C:H:O.

❌

The molecular formula of a polymer formed by linking 10 glucose units through 9 glycosidic bonds is C₆₀H₁₀₂O₅₁, and if these bonds are β glycosidic, the resulting polymer is cellulose with structural rigidity due to hydrogen bonding between parallel chains.

✅

View this question

Want instant access to all verified answers on dle.plaksha.edu.in?

Get Unlimited Answers To Exam Questions - Install Crowdly Extension Now!

Add to Chrome

Telegram Instagram TikTok Question Bank